There is a rumor out there that scientists don’t communicate well with the public.  This may be partially true.  In my opinion, we communicate very little with the public.   We spend a lot of time communicating with each other—scientists write and review grant proposals, write research articles, review research articles, and write opinion pieces.  We attend conferences and give presentations to rooms full of scientists.  But we don’t have a convenient venue for communicating with the public.  Much of what we publish is now “open access”; anyone can access it for free.  The public can read about all of science anytime they want.  So scientists in many ways are communicating to the public, and the public may be reading, however the public doesn’t have an easy way to respond.  Communication is mainly one-sided; we have no mechanism for a conversation. 

            Occasionally the popular press picks up our research.  This happened to my husband, Joseph Schulz.  He studies venomous cone snails that hunt fish and paralyze them with venom shot out of a hollow harpoon.  This is very cool stuff, and he is an amazing scientist.  The press picked up an article he published about how this snail’s venom delivery system is one of the fastest hunting mechanisms ever discovered, not bad for a slow little snail scooting along the ocean floor.  But reporters interviewed my husband and wrote the stories; he didn’t get to communicate to the public directly.  Some stories were better than others, and a few contained errors. 

            I know one scientist who writes books about evolution aimed at a general audience.  Sean Carroll studies fruit flies, like me, and I’ve seen him speak at large conferences devoted to fruit flies.  Dr. Carroll has a fluffy beard and friendly hair.  Despite this modest appearance Dr. Carroll is a rock star—one of the best speakers out there.  I have also seen him give his “book talk” designed for the non-scientist.  He was completely accurate and engaging, but somehow less of a rock star in a non-scientist setting.  It could have been that at the scientific conference there were thousands of people in the room, with four projection screens stretching from floor to ceiling.  We all wanted to hear every word that Dr. Carroll was saying—he was telling us about his research on evolution and development.  The knowledge went from a small group, his lab and perhaps some science friends, colleagues and collaborators, to the “fly” community.  When Sean’s graduate student or postdoc learned something about how evolution actually works, they are the only people on the planet who know it.  That is pretty powerful, and it is the drug that keeps scientists working 60-hour weeks in a lab or in the field for decades.  When Dr. Carroll shared what he knew at the conference, we joined the small group of the only people on the planet to have that insight into how evolution was working.  We were hanging on every word like true fans.  My point is, that at Dr. Carroll’s made-for-public talk he wasn’t providing brand new information, he was explaining what for me was obvious.  But, of course the talk wasn’t meant for me.  So how did a non-scientist perceive it?  I think they liked it, but perhaps didn’t have the background to really understand why evolution is simply that cool. 

            So how should a scientist talk with the public?  What is the goal?  Should scientists explain stem cells so that we can engage in an informed public policy debate on the use of human stem cells in research?  Should scientists explain our genome and genetic testing so that we can decide if the FDA should regulate genome-testing companies like 23 and Me?  What is the forum?  New Yorker articles?  Web sites of prominent news organizations?  Charlie Rose?  Fox News?  It seems that most of the science articles and books are written by non-scientists.  This can work out wonderfully as in The Immortal Life of Henrietta Lacks, but too often I see articles or books with cringing inaccuracies.

            I find science exciting because of the constant novelty.  The edge-of-your-seat-we-didn’t-know-this-yesterday adrenaline rush.  I am teaching material in my courses that I didn’t teach five years ago because no one knew that it happened that way.  And these are not the delicate details that only the nerdiest nerd cares about.  This is fundamental knowledge—that tiny RNA molecules called microRNAs control our development, for example.  I didn’t learn about these tiny RNAs in graduate school, because they were only discovered about ten years ago.  They have since earned several scientists the Nobel Prize, and have completely revolutionized how we think about gene expression, development and disease.  Foundational information is still completely unknown and waiting to be discovered; all we have to do is get into the lab and find it.  Then we can know what no one else on Earth knows–and we can share it.

            I suppose my goal in this essay is to share that feeling.  To try to share that adrenaline rush of knowing a secret about how life works whispered in your ear directly by Mother Nature. 

            In order to do this, I’ve chosen a specific topic.  This is the idea: we are caretakers of our genome.  If we have biological children, we pass our genes on to future generations, and I want to discuss the emerging idea that we have a personal responsibility towards those genes.  Scientists are now wrestling with the idea that our lifestyle can chemically alter our DNA and may affect our children’s children.  Some are calling it Lamarkian evolution, some are calling it over-hyped, and many are just quietly working in laboratories listening for secrets.


First the background:  DNA is the blueprint of life.  We’ve heard it so often the expression is trite.  I have seen a couple of blueprints, and I find the analogy rather confusing.  Blueprints lay out the plans of a house or new landscaping in the utmost detail.  They include layers of information:  electrical, plumbing, walls, doors, etc.   With the blueprint in hand, you could build the house.  If we look at our DNA, could we build a person?  Let’s look at an example of a gene (a small bit of DNA).  This gene carries the instructions for making a protein called beta-globin, one of the proteins that make up hemoglobin.  I chose this only because the hemoglobin of our red blood cells is something most of us are familiar with.  The beta-globin gene, in the language of DNA is:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAG ACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGG TGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGG CAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGAC AACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACT TCAGGGTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAG GAAGGGGATAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCT CAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCT TTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATA TCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAAT ATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAAT CATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAA TTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATA CTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAG AATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAAT TGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTT ATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTT ATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC

            You could figure out where the gene begins to code for the protein, where some spots are skipped over (called introns), and where the gene that codes for protein ends.  And you could use the genetic code to figure out what the protein would look like.  Tada, you’ve made beta-globin.  Simple stuff.  If you built all the proteins in the body would you build a body?  Nope, you’d have a pile of proteins.  Fortunately, the story is far more interesting than that.  The gene for beta-globin is in every cell in our body.  Yet, only cells destined to become red blood cells make beta-globin.  All the other cells must turn that gene off.  And that decision to be “off” must be remembered every time the cell divides. 

            What if the blueprint for your house gave instructions not only for your house, but also for the entire neighborhood:  the corner store, the local school, the library, the big box store and the post office?  And what if the instructions were all intermingled?  What if the blueprint was a living instruction that continually informed the house how to continue to be a house, and to not be a library full of books or a post office full of mail?  Perhaps that would be a tiny bit closer to our DNA.  How do you choose which instructions to follow to build your house?  What if you accidently included a post office in the basement?

            What would happen if a cell made a mistake, and wrongly starting making beta-globin?  I honestly don’t know the answer; I suppose it would probably be okay.  But what if it starting making a protein that told the cell to divide when it wasn’t supposed to?  Then the cell becomes a cancer cell.  Normal cells use several clever mechanisms to remember which genes should be on and which should be off.  And these mechanisms do not involve any changes to the DNA sequence.  As such, these mechanisms operate on top of genetics and scientists have named this gene memory system “epigenetics”.  Epi is taken from Greek and can mean “on top of” or “above”.  Thus our cells running an entire system that is working at a level above genetics.  Cancer is one of many diseases that result from epigenetics run amuck.  Several new drugs target the epigenetics of cancer cells, but our understanding of epigenetics is very basic.  So like many cancer drugs, they are given to patients without a full understanding of possible long-term consequences.

            What happened to cause the cell to change its instructions and turn on (or off) the wrong gene?  Who changed the epigenetic instructions?  Who caused the post office to be built in the basement?  The answer may be mundane.  It may be BPA that leached out from a water bottle, the amount of veggies eaten over a lifetime, a fungicide used on wine grapes, the diet of an ancestor, or random chance.  Unfortunately, the mundane is hard to study, because everything is mundane.  Yet studying the unexciting is turning out to be a most exciting field of science.  Our daily lives are chemically altering our genome in a way that is changing how our blueprint is read.  It explains why identical twins (with the same blueprints) look and act different.  Their genes are not used in the same way.  Young twins are very similar, while older twins show more differences.  As people age, their life experiences literally change who they are. 

            The life experiences that change our DNA can begin on the first day of life.  When mother rats licked their pups frequently the baby rats grow up well adjusted and able to cope with stress.  Rats who neglect their offspring (in that they do not frequently lick their pups) have baby rats that grow up fearful with heightened reactions to stress.  The resulting stress in these pups could be reversed by treatment with a drug called trichostatin A.   Analysis of the DNA in the hippocampus regions of their brains showed permanent chemical changes as a result of the different mothering styles, and the drug could reverse those changes.  Genetically speaking, we are not so different from rats.  This landmark study showed that early maternal care permanently changed the instructions in a baby rat’s DNA, and those instructions were remembered his whole life.  It is difficult to avoid extrapolating to Homo sapiens.  Do early parenting experiences alter our ability to deal with stress?  Is DNA altered by parenting?

            If a gene that encodes a protein important for epigenetics is changed by a mutation, the consequences could be large-scale changes in gene expression.  This mutation in one gene then has huge implications for evolution.  A mutation in an epigenetic pathway could have drastic consequences for the resulting organism.  Those consequences may allow it to adapt to its environment in a way that is rapid and efficient. 

            I read that one should not include too many scientific details in science essays, because although scientists drool over those crossed t’s and dotted i’s, it seems that science details make normal people feel icky.  If that is true, I think it’s a shame.  Somehow scientists have to do a better job of conveying why appreciating the stigmas and anthers of a rose only makes it smell sweeter.  We have to convey that biology is a vast, complex arrangement of dancing molecules that softly speak to each other.  That those whispered messages are what allow us to do anything and everything:  have an idea, type these words, or run down the road laughing.  That life is profoundly and impossibility complicated, and yet it exists.  And that we can stand up and humbly proclaim, “I want to understand what it means to be alive”.  Studying biology is to biologists what I suppose religion may be to others.  I am not going to go all Richard Dawkins here, but most biologists are not religious.  In fact, when Francis Collins was elected head of the National Institutes of Health, there were articles in scientific journals wondering if it was a good idea to let a self-proclaimed Christian run the largest scientific funding agency in the U.S.  To a biologist, biological discoveries are heady and all consuming.  Whether one studies evolution and Darwin’s “endless forms most beautiful” or molecular biology’s double helix, Biology is mysterious, intricate, and awe-inspiring all on its own.

            It is now time to grab the bull by the horns (or the rat by the tail?) and go into the awe-inspiring details.  I am going to ignore the advice clearly spelled out in A Field Guide for Science Writers, a wonderfully comprehensive and well-written book whose cover explains that it is the Official Guide of the National Association of Science Writers, the very same book that told me not to go into too many details.  Oh yes, another thing about scientists, we tend to stumble into places with signs that read, “Keep out”.  We are used to getting our new boots stuck in the mud, so let’s get slogging.

            To appreciate epigenetics, which is of course “on top of” genetics, we must embrace genetics.  Which is to say we must fully engage with the structure of DNA.  Starting big and moving to little:  our bodies are made of organs (liver, brain, skin, heart) in addition to muscles, connective tissues, blood and bones to name a few.  Those parts are made of cells.  Each cell is so small you cannot see it without a microscope.  Dust is mainly dead skin cells that constantly slough off of our bodies (that reminds me, I really should dust).  Inside each cell is a nucleus, and inside that nucleus is our DNA.  Our complete genome, 6 billion base pairs, is inside each cell.  The words “base pairs” refer to the bases in our DNA, which are the letters in the alphabet used by the blueprint.  We have four bases: adenine, cytosine, guanine and thymine.  Figure 1 shows that they are gorgeous little ring structures made of carbon (C), nitrogen (N), hydrogen (H) and oxygen (O).  The lines between the carbon, nitrogen, hydrogen and oxygen atoms represent covalent bonds.  Covalent bonds are the forces that hold atoms together; they are a result of atoms sharing electrons.  Single lines are single covalent bonds in which the atoms are sharing one pair of electrons, and double lines are double covalent bonds in which the atoms are sharing two pairs of electrons.

                     

            The DNA bases are connected to a sugar called deoxyribose, which is connected to a phosphate molecule (Figure 2).  The phosphate (phosphorus and oxygens) is negatively charged, and is therefore acidic.  The full name of DNA is deoxyribonucleic acid, and the phosphate + deoxyribose + base is called a nucleotide.  Figure 2 shows an example of deoxyadenosine monophosphate (the deoxyribose + adenine + one phosphate).  In order to keep track of who is bound to whom, the carbons on the sugar are numbered 1’ (pronounced “one prime”), 2’, 3’, 4’ and 5’.  They are primes because the atoms on the bases are also numbered (that’ll come back later); the primes tell you if you are talking about the base or the sugar.  Figure 2 shows how phosphate group is connected to the 5’ carbon on the sugar, and there is an oxygen and a hydrogen (called a hydroxyl group), connected to the 3’ carbon. 

                                        

            Now I fear I may have lost a few of you.  That’s okay.  There isn’t a quiz at the end of this essay, and at least getting used to looking at these adorable molecules will explain some of the ideas that are coming in a moment.

            A strand of DNA is a bunch of nucleotides connected to each other; Figure 3 portrays the sequence adenine, cytosine, adenine, thymine (ACAT).  For convenience, the carbons are not written, but are inferred as the corners of the molecules (but you remember where they were from Figures 1 and 2).  Those four bases, ACAT, happen to be the beginning of the sequence for human beta-globin from earlier, just to show you something friendly and familiar.  There is a subtlety in this single strand of DNA, and that is that I’ve begun my drawing with a phosphate on the top and ended with a sugar at the bottom.  The DNA strand is directional. So we can look at our single strand of DNA in Figure 3 and note that it is going 5’ to 3’, top to bottom.  If this were my Introductory Biology class in college, that idea would be on the next exam.  This is fundamental, foundational DNA knowledge.  The 5’ to 3’ directionality of DNA is necessary for the understanding how genes are “read” when they are turned on and how DNA is copied each time a cell divides.

                                          

            While figure 3 is admittedly somewhat complicated, DNA is not single-stranded; it is double-stranded and so we are half done.  To draw the second strand of DNA we follow the base-pair rules.  Adenine pairs with thymine and guanine pairs with cytosine.  We draw in the second strand of DNA, filling in each appropriate base-to-base pair with its partner.  One more rule, the second strand goes in the opposite direction (so 3’ to 5’ top to bottom), such that the two strands are parallel to each other but facing opposite directions so to speak (called anti-parallel) (Figure 4).  The dots in Figure 4 are hydrogen bonds, which occur when hydrogen is attracted to a nearby oxygen or nitrogen atom.  Hydrogen bonds are weak, so when the DNA needs to be copied or read, the two strands of DNA can be pulled apart.

         

            The sequence of the beta-globin gene from the start of this essay only showed you one strand, which is the usual way to write a DNA sequence, but you can use the A-T and G-C base pair rules to figure out what the complementary strand should be.  Your cells use the base pairing rules to build new DNA prior to dividing.  After all, each new daughter cell must each have her own full set of DNA.  A gaggle of proteins comes in and pulls apart a portion of the double helix, a little bit at a time, building the new DNA using each single strand as a template.  When you look at the molecule and think about Goldilocks and the Three Bears it becomes obvious why the base pairing rules are what they are.  Thymine and cytosine have one ring.  If they paired with each other they would be too small to reach across to the other DNA strand.  If adenine and guanine, each with their two rings, paired together they would be too big.  One double-ringed base paired with a single ring base is just right.  We are built using a language of only four letters, and we have a beautiful copying system built into the double-stranded DNA molecule.  The whole thing is what biologists call elegant.  Not to mention that every living organism on Earth uses the same DNA, from bacteria to bees to bananas.  In a final flourish, the molecule gently twists on itself, forming the charming double helix (Figure 5). 

                                               

            DNA has always been there, as long as there has been recognizable life on Earth.  The molecule is perhaps 3 and a half billion years old.  And yet its structure has only been understood since 1953.  Since then, however, the pace of discovery in regards to DNA has picked up.  Suffice it to say that we understand basically how a small length of DNA (called a gene) is read to form a protein.  I am what I am because of my genome:  the arrangement of 6 billion A’s and T’s and C’s and G’s.  Except that may not be completely correct, perhaps it’s wrong; my DNA may not be the whole story.  And that’s what the rest of this essay is about.

            Let’s go back.  Recall that chemical changes happened to a rat’s DNA as a consequence of parenting.  A chemical change means that the chemistry is altered.  Various environmental conditions (such as maternal care) can result in the addition of four atoms.  One carbon and three hydrogens (called a methyl group) can be added to the base cytosine (the “C” in our DNA 4-letter alphabet).  Not any cytosine, mind you, only cytosines that are followed by a guanine (the “G”) are candidates for the addition of a methyl group.  So our DNA sequence in Figure 4 could not be chemically changed, it could not be “methylated” since it does not contain the sequence “CG”.  When a methyl group is added to a cytosine (in the sequence “CG”), it is added to carbon number 5.  So the resulting base is called 5-methylcytosine (figure 6, arrow points to methyl group). 

                                      

            There are often a lot of “CG” sequences found in the regions of DNA that control whether a gene will be read.  As shown in Figure 7, if many of those CG sequences are methylated, then the gene is turned off, it is not read, and no protein product is made.  If the CG sequences are not burdened with methyl groups, the gene is turned on, it is read, and voilà, protein!  The methylation of cytosine is like a traffic light in that its absence allows the gene to be on, and its presence forces the gene to be off.  We need 5-methylcytosines in our genome, but we need them in the right places in the right cells.  A few methyl groups are misplaced and a healthy cell that knew its place in the body becomes a cancerous cell that can overrun the body.  Four atoms can take a life.

            We used to wonder whether our fates were determined by nature or nurture.  Now we are learning that nurture is changing the fate of nature.  We are learning that the addition or loss of methyl groups (carbon with its three hydrogens) is one method by which we are shaped by our environment.  A new field called environmental epigenomics has been called into existence.  And our 5-methylcytosine is not even the whole story.  DNA is wrapped around little proteins called histones, and those proteins can be chemically changed by the addition of methyl, phosphates and other chemical groups.  Those changes to the histone proteins also control whether a gene is on or off.  The histone changes can inform the 5-methylcytosines, and vice versa.  The more we learn about Biology, the more we realize that we know so very little.  And the idea that there is so much to discover about ourselves is what fuels the late nights and long weekends in the lab.

            A few years ago scientists published an experiment where the endocrine (a hormone)-disrupting chemical Bisphenol A (BPA, recently banned from baby bottles in some states and no longer found in my Nalgene water bottle) was given to pregnant mice.  The offspring of those BPA-fed mice had fewer methyl groups on specific cytosines, and their genetic background was such that they were more likely to be overweight and suffer from various diseases if they carried fewer methyl groups on their DNA.  If the mothers were fed nutritional supplements such as folic acid to counteract the BPA, the methyl groups were not lost, and the mice were slim and healthy.  BPA is linked to a laundry list of health issues in humans and other animals.  Nevertheless, BPA is still found in the linings of most food cans, and you are exposed if you frequently touch thermal paper used for many receipts.  Scientists don’t know if BPA changes human DNA, and it is very difficult to do the experiment.  It is not ethical to purposely expose humans to BPA.

            But the news from the epigenetics front isn’t all grim.  Scientists recently learned that they could change the addition of chemical groups to their own personal histones by eating one giant serving (68 grams) of broccoli sprouts together with a bagel and cream cheese.  The idea is that broccoli contains a chemical that may prevent cancer, and this chemical is particularly concentrated in broccoli sprouts.  The same chemical prevented human prostate cancer cells from growing in a mouse, a result that holds great promise yet doesn’t really speak directly to human health.  A single large serving had a short-term effect on human chromosomes.  It is completely unknown whether a lifetime of healthy eating could modify our genome in such a way to prevent our cells from going rogue and becoming cancerous.  There are many questions that continue to be asked, and some of them will eventually be answered.

            A more disturbing finding was published several years ago in the prestigious journal Science.  Pregnant rats were given vinclozolin, a fungicide often used on wine grapes.  Like BPA, vinclozolin is an endocrine disruptor.  The male offspring of those rats had reduced fertility and an increase in methylation of their DNA in their sperm.  The sons of those rats also had reduced fertility and an increase in DNA methylation in their sperm.  And the sons of the sons had reduced fertility and an increase in DNA methylation in their sperm.  This epigenetic effect could be followed for up to three generations.  This shouldn’t be so.  Patterns of 5-methylcytosines are erased and reset each generation.  Something was protecting the 5-methylcytosines of the sons of the vinclozolin-treated rats.  The amount of vinclozolin given to the mother rats was quite high, higher than what animals living in the vineyards should experience, and higher than what we should experience.  We don’t yet know the effects of lower doses, or if vinclozolin alters human DNA.  The passing of epigenetic chemical changes from generation to generation is called transgenerational inheritance.  This is the unclear aspect of epigenetics.  Nevertheless, several scientists are convinced that transgenerational epigenetic inheritance occurs in humans.

            Epigenetics was introduced to the public by a 2007 PBS NOVA episode “Ghost in your Genes”.  The epigenetics documentary led with the story of two identical twin girls who were about 10 years old.  One twin was already talking about which college she would attend.  In the scene, she was helping her mom by setting the table.  Her identical twin wasn’t talking about colleges; she is severely autistic and spends her days wiping her spit on a computer screen.  The documentary never explained how the identical twins became so different, but it was suggested that it was due to an epigenetic cause such as a misplaced 5-methylcytosine or mistakes in chemical changes to the histone proteins that bind DNA.  I don’t know why one twin has autism and one doesn’t, and it is quite possible it is not epigenetic in origin.  But it was compelling storytelling to begin the NOVA episode with strong characters and a biological puzzle.  The NOVA episode ended with another biological puzzle, findings from Sweden that report a correlation between health and longevity of individuals and the diet eaten by their grandparents.  If the grandfather experienced a famine just prior to puberty, then the grandson was less likely to die of cardiovascular disease or diabetes.  If however, the grandfather had access to a good food supply during mid-childhood, his grandson would have an increased mortality.  One hypothesis to explain this bizarre observation is that perhaps there is a mechanism of informing future generations of the environment and food availability.  How that happens at the level of the DNA, or whether it happens at the level of DNA is totally unknown.

            An article recently published in the top tier Biology journal Cell may have made some inroads into the seemingly intractable problem of transgenerational inheritance.  Male mice were given a low protein diet, although the missing protein was made up for by sugar.  So it could be thought of as a low protein/high sugar diet.  Those males were briefly introduced to females (who were fed a normal diet), and the males were removed after mating.  The females raised the resulting pups for three weeks, at which point the scientists asked whether every gene (there are about 20,000 genes in mice) was on or off in the pups’ livers.  This experiment is representative of the post-genomic era of biology.  Less than ten years ago, scientists would not have even considered doing such a crazy and ambitious experiment because it would have been basically impossible.  Now that we have sequenced the genome of the mouse (many times over), and robotic technologies allow one to make tiny slides with thousands and thousands of DNA bits stuck to them, this type of experiment is nearly routine.  This particular experiment used 38,784 tiny bits of DNA to effectively probe the gene expression in the rat livers, easily covering every gene.   The scientists found that the diet eaten by the father affected the expression of 445 different genes in the offspring.  Out of those 445 genes, one group of genes stood out as tantalizing:  if the father was fed a low protein diet, the offspring responded by making more of the proteins that are needed to make fat and cholesterol.  And at least one of those genes saw an increase in 5-methylcytosine.  Thus, somehow the diet of the father was conveyed to his progeny, presumably through his sperm since the father was removed from the cage before his pups were born.  No one knows how that happens, but many people are excited about the possibilities, not to mention whether this is also happening in us.  Having a mouse “model” for diet-based transgenerational inheritance provides scientists with a way to ask questions about what in the world in going on.

            The above paragraph was quite sciency.  Hopefully you have enough vocabulary and you are interested enough in the story to begin asking questions.  For example, was the DNA in the father’s sperm methylated differently following his low protein diet?  (no, it wasn’t)  If you find yourself awake at night thinking about these mice and their methylated offspring and whether humans experience transgenerational inheritance, then you’ve got the science bug!

            As a side note, the self-help world has evidently embraced epigenetics and the inspiration that we are not simply creatures of our genes.  If we can alter our DNA by life experiences, our potential is certainly not limited by mere genetics.  We can be a baseball star or an opera singer, all we have to do is give ourselves the right experiences.  Why the skills for being a great baseball player should be in our genes in the first place is unclear to me.  Somehow “practice makes perfect” was replaced by “it’s in our genes”, and now the pendulum is swinging back the other way.  I hope I’ve convinced you that the actual science is far more complicated, beautiful and weird than any self-help book.

            Science somehow moves at a breakneck speed while it takes an eternity to get anywhere.  We wait decades for answers to some questions, while unimaginable discoveries come crashing through the laboratory door.  This is a contradiction that is hard for scientists to convey:  Biology is moving so fast that we must not expect too much too soon.  I think that we shouldn’t underestimate our audience, and that the details will be welcomed if presented well.  And I hope I have done just a little bit of that, because I think science is too cool to keep just for us scientists.  It must be shared.

            The idea that our environment alters our genes is becoming more accepted.  What is lurking on the sidelines of science is that our life experiences may alter the health of our children’s children.  This idea of a responsibility to future generations is not new from an environmental, Earth-conscience perspective.  But it is new from a personal, nutritional, DNA-perspective.  What we eat or don’t eat today could affect our grandchildren 50 years from now.  I wonder where I can buy broccoli sprouts….


Sources:

Anway MD, Cupp AS, Uzumcu M, Skinner MK. 2005. Epigenetic transgenerational actions of endocrine disruptors and male fertility. Science 308:1466–69

Carone BR, Fauquier L, Habib N, Shea JM, Hart CE, Li R, Bock C, Li C, Gu H, Zamore PD, Meissner A, Weng Z, Hofmann HA, Friedman N, Rando OJ. 2010. Paternally induced transgenerational environmental reprogramming of metabolic gene expression in mammals. Cell 143:1084-96.

Dolinoy DC, Huang D, Jirtle RL. 2007. Maternal nutrient supplementation counteracts  bisphenol A-induced DNA hypomethylation in early development. Proc Natl Acad Sci  U S A. 104:13056-61.

Fraga MF, Ballestar E, Paz MF, Ropero S, Setien F, Ballestar ML, Heine-Suñer D, Cigudosa JC, Urioste M, Benitez J, Boix-Chornet M, Sanchez-Aguilera A, Ling C, Carlsson E, Poulsen P, Vaag A, Stephan Z, Spector TD, Wu YZ, Plass C, Esteller M. 2005. Epigenetic differences arise during the lifetime of monozygotic twins. Proc Natl  Acad Sci U S A. 102:10604-9.

Kaati, G., Bygren, L.O., and Edvinsson, S. 2002. Cardiovascular and diabetes mortality determined by nutrition during parents’ and grandparents’ slow growth period. Eur. J. Hum. Genet. 10:682–688.

Kundakovic M, Champagne FA. 2011. Epigenetic perspective on the developmental effects of bisphenol A. Brain Behav Immun. 25:1084-93.

Myzak MC, Tong P, Dashwood WM, Dashwood RH, Ho E. 2007. Sulforaphane retards the growth of human PC-3 xenografts and inhibits HDAC activity in human subjects. Exp Biol 232:227-34.

Pembrey, M.E., Bygren, L.O., Kaati, G., Edvinsson, S., Northstone, K., Sjostrom, M., and Golding, J. 2006. Sex-specific, male-line transgenerational responses in humans. Eur. J. Hum. Genet. 14:159–166.

Walker DM, Gore AC. 2011. Transgenerational neuroendocrine disruption of reproduction. Nat Rev Endocrinol. 7:197-207.

Weaver IC, Cervoni N, Champagne FA, D’Alessio AC, Sharma S, et al. 2004. Epigenetic programming by maternal behavior. Nat. Neurosci. 7:847–54

Youngson NA and Whitelaw E. 2008. Transgenerational Epigenetic Effects. Annual Review of Genomics and Human Genetics 9: 233-257

 

 

Through teaching undergraduates in the classroom setting and the research laboratory I have begun to appreciate the challenges in communicating science.  I worry that the gulf between scientists and the general public is widening.  While my students are quite intelligent, I feel they are learning less science in high school, and are struggling more with critical thinking skills.  I find it fascinating that many people would never claim to understand the Theory of Relativity, yet feel perfectly comfortable criticizing the Theory of Evolution without understanding a bit of Biology.  I thought it would be a worthwhile challenge to try to communicate biology to non-biologists in the style of creative nonfiction.